LAST Tutorial
=============

LAST finds similar regions between sequences, and aligns them.

Example 1: Compare the human and fugu mitochondrial genomes
-----------------------------------------------------------

For our first example, we wish to find and align similar regions
between the human and fugu mitochondrial genomes.  You can find these
sequences in the examples directory: humanMito.fa and fuguMito.fa.  We
can compare them like this::

  lastdb -cR01 humdb humanMito.fa
  lastal humdb fuguMito.fa > myalns.maf

The lastdb command creates several files whose names begin with
"humdb".  The lastal command then compares fuguMito.fa to the humdb
files, and writes the alignments to a file called "myalns.maf".

The "-cR01" option suppresses alignments caused by simple sequence
such as cacacacacacacacacacacaca.

Understanding the output
------------------------

The output has very long lines, so you need to view it without
line-wrapping.  For example, with a Unix/Linux/MacOsX command line,
you can use::

  less -S myalns.maf

Each alignment looks like this::

  a score=27 EG2=4.7e+04 E=2.6e-05
  s humanMito 2170 145 + 16571 AGTAGGCCTAAAAGCAGCCACCAATTAAGAAAGCGTT...
  s fuguMito  1648 142 + 16447 AGTAGGCTTAGAAGCAGCCACCA--CAAGAAAGCGTT...

The score is a measure of how strong the similarity is.  EG2 and E are
explained at `<last-evalues.html>`_.  Lines starting with "s" contain:
the sequence name, the start coordinate of the alignment, the number
of bases spanned by the alignment, the strand, the sequence length,
and the aligned bases.

The start coordinates are zero-based.  This means that, if the
alignment begins right at the start of a sequence, the coordinate is
0.  If the strand is "-", the start coordinate is in the reverse
strand.

This alignment format is called `MAF (multiple alignment format)
<http://genome.ucsc.edu/FAQ/FAQformat.html#format5>`_.  You can
convert it to several other formats using `maf-convert
<maf-convert.html>`_.  You can make lastal produce a few other formats
with option -f (see `<lastal.html>`_).

Example 2: Compare vertebrate proteins to invertebrate proteins
---------------------------------------------------------------

Use the lastdb -p option to indicate that the sequences are proteins::

  lastdb -p -cR01 invdb invertebrate.fa
  lastal invdb vertebrate.fa

Example 3: Compare DNA sequences to protein sequences
-----------------------------------------------------

Here we use the -F15 option, to specify translated alignment with a
score penalty of 15 for frameshifts::

  lastdb -p -cR01 protdb proteins.fa
  lastal -F15 protdb dnas.fa

Example 4: Find short protein alignments
----------------------------------------

LAST uses a `scoring scheme <last-matrices.html>`_ to find
similarities.  Some scoring schemes are good for long-and-weak
similarities, others for short-and-strong similarities.  If we seek
very short similarities, weak ones are hopeless (statistically
insignificant), so we had better focus on strong ones.  The PAM30
scoring scheme may work well::

  lastdb -p -cR01 invdb invertebrate.fa
  lastal -pPAM30 invdb vertebrate.fa

(How short is "very short"?  It depends on the amount of sequence data
we are searching, but perhaps roughly less than 40 amino acids.)

Example 5: Align human DNA reads to the human genome
----------------------------------------------------

Suppose we have DNA reads in a file called reads.fastq, in
fastq-sanger format.  We can align them to the human genome like
this::

  lastdb -uNEAR humandb human/chr*.fa
  lastal -Q1 -e120 humandb reads.fastq | last-split > myalns.maf

This will use about 15 gigabytes of memory.

* -uNEAR selects a `seeding scheme <last-seeds.html>`_ that makes it
  better at finding short-and-strong similarities.  (It also changes
  the default scoring scheme.)

* The -Q1 option indicates that the reads are in fastq-sanger format.

* The -e120 option requests alignments with score ≥ 120.  This is
  intentionally a somewhat low score (high E-value): last-split then
  discards low-confidence alignments, but it uses them to estimate the
  ambiguity of high-confidence alignments.

* last-split reads the alignments produced by lastal, and looks for a
  unique best alignment for each part of each read.  It allows
  different parts of one read to match different parts of the genome.
  It has several useful options, please see `<last-split.html>`_.

Paired reads
------------

If you have paired reads, there are two options:

1. Use last-pair-probs (see `<last-pair-probs.html>`_).

2. Ignore the pairing information, and align the reads individually
   (using last-split as above).  This may be useful because
   last-pair-probs does not currently allow different parts of one
   read to match different parts of the genome, though it does allow
   the two reads in a pair to match (e.g.) different chromosomes.

Fastq format confusion
----------------------

Unfortunately, there is more than one fastq format (see
http://nar.oxfordjournals.org/content/38/6/1767.long).  Recently
(2013) fastq-sanger seems to be dominant, but if you have another
variant you need to change the -Q option (see `<lastal.html>`_).

Example 6: Align human fasta reads to the human genome
------------------------------------------------------

If our reads are in fasta instead of fastq format, we simply omit -Q::

  lastdb -uNEAR humandb human/chr*.fa
  lastal -e120 humandb reads.fa | last-split > myalns.maf

(In older versions of LAST, we had to set a short-and-strong scoring
scheme, but this is now done automatically by -uNEAR.)

Example 7: Align aardvark fastq reads to the human genome
---------------------------------------------------------

In this case we expect weak similarities, so we omit -uNEAR.  We also
need to change the scoring scheme (because with -Q1 it defaults to a
short-and-strong scoring scheme)::

  lastdb -cR01 humandb human/chr*.fa
  lastal -Q1 -r5 -q5 -a35 -b5 humandb reads.fastq > myalns.maf

Option -r5 sets the match score to 5, -q5 sets the mismatch cost to 5,
while -a35 and -b5 set the gap cost to 35 + 5×(gap length).

(Why use 5:5:35:5 rather than 1:1:7:1?  The reason is that 5:5:35:5
has roughly the same scale as the fastq quality scores.  lastal uses
the quality scores to modify the alignment scores, and then rounds the
modified scores to integers.  If we used 1:1:7:1, the integer-rounding
would lose information.)

Very short reads
----------------

WARNING!  The standard score parameters do not align very short reads.
This is because the match score is 6 and the score threshold is 120,
so at least 20 high-quality matches are required (or a greater number
of low-quality matches).  In addition, last-split discards
low-confidence alignments.  To align very short reads, reduce lastal's
score threshold (-e) or increase last-split's error threshold (-m).

If the score threshold is too low, you will get meaningless, random
alignments.

Tuning speed, sensitivity, memory and disk usage
------------------------------------------------

* You can make LAST faster by `using multiple CPUs
  <last-parallel.html>`_.

* You can `trade off speed, sensitivity, memory and disk usage
  <last-tuning.html>`_.

Example 8: Compare the cat and rat genomes
------------------------------------------

If you have ~50 GB of memory and don't mind waiting a few days, this
is a good way to compare such genomes::

  lastdb -cR11 -uMAM8 catdb cat.fa
  lastal -m100 -E0.05 catdb rat.fa | last-split -m1 > out.maf

This looks for a unique best alignment for each part of each rat
chromosome.  Omitting -m100 makes it faster but somewhat less
sensitive.  Omitting -uMAM8 reduces the memory use to ~10 GB and makes
it faster but considerably less sensitive.

This recipe aligns each rat base-pair to at most one cat base-pair,
but not necessarily vice-versa.  You can get strictly 1-to-1
alignments by swapping the sequences and running last-split again::

  maf-swap out.maf | last-split -m1 > out2.maf

Example 9: Compare the human and chimp genomes
----------------------------------------------

For strongly similar genomes (e.g. 99% identity), something like this
is more appropriate::

  lastdb -cR11 -uNEAR human human.fa
  lastal -m50 -E0.05 human chimp.fa | last-split -m1 > out.maf

Example 10: Ambiguity of alignment columns
------------------------------------------

Consider this alignment::

  TGAAGTTAAAGGTATATGAATTCCAATTCTTAACCCCCCTATTAAACGAATATCTTG
  |||||||| ||||||  |  ||  | |  |    || ||||||   |||||||||||
  TGAAGTTAGAGGTAT--GGTTTTGAGTAGT----CCTCCTATTTTTCGAATATCTTG

The middle section has such weak similarity that its precise alignment
cannot be confidently inferred.

It is sometimes useful to estimate the ambiguity of each column in an
alignment.  We can do that using lastal option -j4::

  lastdb -cR01 humdb humanMito.fa
  lastal -j4 humdb fuguMito.fa > myalns.maf

The output looks like this::

  a score=17 EG2=9.3e+09 E=5e-06
  s seqX 0 57 + 57 TGAAGTTAAAGGTATATGAATTCCAATTCTTAACCCCCCTATTAAACGAATATCTTG
  s seqY 0 51 + 51 TGAAGTTAGAGGTAT--GGTTTTGAGTAGT----CCTCCTATTTTTCGAATATCTTG
  p                %*.14442011.(%##"%$$$$###""!!!""""&'(*,340.,,.~~~~~~~~~~~

The "p" line indicates the probability that each column is wrongly
aligned, using a compact code (the same as fastq-sanger format):

  ======  =================   ======  =================
  Symbol  Error probability   Symbol  Error probability
  ------  -----------------   ------  -----------------
  ``!``   0.79 -- 1           ``0``   0.025 -- 0.032
  ``"``   0.63 -- 0.79        ``1``   0.02  -- 0.025
  ``#``   0.5  -- 0.63        ``2``   0.016 -- 0.02
  ``$``   0.4  -- 0.5         ``3``   0.013 -- 0.016
  ``%``   0.32 -- 0.4         ``4``   0.01  -- 0.013
  ``&``   0.25 -- 0.32        ``5``   0.0079 -- 0.01
  ``'``   0.2  -- 0.25        ``6``   0.0063 -- 0.0079
  ``(``   0.16 -- 0.2         ``7``   0.005  -- 0.0063
  ``)``   0.13 -- 0.16        ``8``   0.004  -- 0.005
  ``*``   0.1  -- 0.13        ``9``   0.0032 -- 0.004
  ``+``   0.079 -- 0.1        ``:``   0.0025 -- 0.0032
  ``,``   0.063 -- 0.079      ``;``   0.002  -- 0.0025
  ``-``   0.05  -- 0.063      ``<``   0.0016 -- 0.002
  ``.``   0.04  -- 0.05       ``=``   0.0013 -- 0.0016
  ``/``   0.032 -- 0.04       ``>``   0.001  -- 0.0013
  ======  =================   ======  =================

Note that each alignment is grown from a "core" region, and the
ambiguity estimates assume that the core is correctly aligned.  The
core is indicated by "~" symbols, and it contains exact matches only.

LAST has options to find alignments with optimal column probabilities,
instead of optimal score: see `<lastal.html>`_.
